extraction

I have an image that contains more than one bounding box. I need to extract everything that has bounding boxes in them. So far, from this site I've gotten this answer: y = img[by:by+bh, bx:bx+bw] cv2.imwrite(string + '.png', y) It works, however, it only gets one. How should I modify the code? I tried putting it in the loop for contours but it still spews out one image instead of multiple ones. Thank you so much in advance. Zaw Lin there you go: import cv2 im = cv2.imread('c:/data/ph.jpg') gray=cv2.cvtColor(im,cv2.COLOR_BGR2GRAY) contours, hierarchy = cv2.findContours(gray,cv2.RETR_LIST,cv2

My objective is to extract the text and images from a PDF file while parsing its structure. The scope for parsing the structure is not exhaustive; I only need to be able to identify headings and paragraphs. I have tried a few of different things, but I did not get very far in any of them: Convert PDF to text. It does not work for me as I lose images and the structure of the document. Convert PDF to HTML. I found a few tools that helped me with this, and the best one so far is pdftohtml. The tool is really good presentation wise, but I haven't been able to successfully parse the HTML. Convert

Assume my git repository has the following structure: /.git /Project /Project/SubProject-0 /Project/SubProject-1 /Project/SubProject-2 and the repository has quite some commits. Now one of the subprojects (SubProject-0) grows pretty big, and I want to take SubProject-0 out and set it up as a standalone project. Is it possible to extract all the commit history involving SubProject-0 from the parent git repository and move it to a new one? See http://git-scm.com/docs/git-filter-branch I think you need something like git filter-branch --subdirectory-filter Project/SubProject-0 --prune-empty -- -

Does anybody know how to extract a column from a multi-dimensional array in Python? >>> import numpy as np >>> A = np.array([[1,2,3,4],[5,6,7,8]]) >>> A array([[1, 2, 3, 4], [5, 6, 7, 8]]) >>> A[:,2] # returns the third columm array([3, 7]) See also: "numpy.arange" and "reshape" to allocate memory Example: (Allocating a array with shaping of matrix (3x4)) nrows = 3 ncols = 4 my_array = numpy.arange(nrows*ncols, dtype='double') my_array = my_array.reshape(nrows, ncols) Martin Geisler Could it be that you're using a NumPy array ? Python has the array module, but that does not support multi

I have the following sequences which is in a fasta format with sequence header and its nucleotides. How can I randomly extract the sequences. For example I would like to randomly select 2 sequences out of the total sequences. There are tools provided to do so is to extract according to percentage but not the number of sequences. Can anyone help me? A.fasta >chr1:1310706-1310726 GACGGTTTCCGGTTAGTGGAA >chr1:901959-901979 GAGGGCTTTCTGGAGAAGGAG >chr1:983001-983021 GTCCGCTTGCGGGACCTGGGG >chr1:984333-984353 CTGGAATTCCGGGCGCTGGAG >chr1:1154147-1154167 GAGATCGTCCGGGACCTGGGT Expected Output >chr1

Alright with the way below it is extracting only referring url like this the extraction code : foreach (HtmlNode link in hdDoc.DocumentNode.SelectNodes("//a[@href]")) { lsLinks.Add(link.Attributes["href"].Value.ToString()); } The url code <a href="Login.aspx">Login</a> The extracted url Login.aspx But i want to get real link what browser parsed like http://www.monstermmorpg.com/Login.aspx I can do it with checking the url whether containing http and if not add the domain value but it may cause some problems at some occasions and i think not a very wise solution. c# 4.0 , HtmlAgilityPack.1.4.0