I have the following sequences which is in a fasta format with sequence header and its nucleotides. How can I randomly extract the sequences. For example I would like to randomly select 2 sequences out of the total sequences. There are tools provided to do so is to extract according to percentage but not the number of sequences. Can anyone help me?
A.fasta
>chr1:1310706-1310726
GACGGTTTCCGGTTAGTGGAA
>chr1:901959-901979
GAGGGCTTTCTGGAGAAGGAG
>chr1:983001-983021
GTCCGCTTGCGGGACCTGGGG
>chr1:984333-984353
CTGGAATTCCGGGCGCTGGAG
>chr1:1154147-1154167
GAGATCGTCCGGGACCTGGGT
Expected Output
>chr1:1154147-1154167
GAGATCGTCCGGGACCTGGGT
>chr1:901959-901979
GAGGGCTTTCTGGAGAAGGAG
If you are working with fasta files use BioPython, to get n sequences use random.sample:
from Bio import SeqIO
from random import sample
with open("foo.fasta") as f:
seqs = SeqIO.parse(f,"fasta")
print(sample(list(seqs), 2))
Output:
[SeqRecord(seq=Seq('GAGATCGTCCGGGACCTGGGT', SingleLetterAlphabet()), id='chr1:1154147-1154167', name='chr1:1154147-1154167', description='chr1:1154147-1154167', dbxrefs=[]), SeqRecord(seq=Seq('GTCCGCTTGCGGGACCTGGGG', SingleLetterAlphabet()), id='chr1:983001-983021', name='chr1:983001-983021', description='chr1:983001-983021', dbxrefs=[])]
You can extract the strings if necessary:
print([(seq.name,str(seq.seq)) for seq in sample(list(seqs),2)])
[('chr1:1310706-1310726', 'GACGGTTTCCGGTTAGTGGAA'), ('chr1:983001-983021', 'GTCCGCTTGCGGGACCTGGGG')]
If the lines were always in pairs and you skipped the metadata at the top you could zip:
from random import sample
with open("foo.fasta") as f:
print(sample(list(zip(f, f)), 2))
Which will give you pairs of lines in tuples:
[('>chr1:983001-983021\n', 'GTCCGCTTGCGGGACCTGGGG\n'), ('>chr1:984333-984353\n', 'CTGGAATTCCGGGCGCTGGAG\n')]
To get the lines ready to be written:
from Bio import SeqIO
from random import sample
with open("foo.fasta") as f:
seqs = SeqIO.parse(f, "fasta")
samps = ((seq.name, seq.seq) for seq in sample(list(seqs),2))
for samp in samps:
print(">{}\n{}".format(*samp))
Output:
>chr1:1310706-1310726
GACGGTTTCCGGTTAGTGGAA
>chr1:983001-983021
GTCCGCTTGCGGGACCTGGGG
Given the file format that you have shown, and assuming that the file is not too large, you don't need any external module (e.g. biopython) to do this:
import random
with open('A.fasta') as f:
data = f.read().splitlines()
for i in random.sample(range(0, len(data), 2), 2):
print data[i]
print data[i+1]
Example output:
>chr1:984333-984353 CTGGAATTCCGGGCGCTGGAG >chr1:901959-901979 GAGGGCTTTCTGGAGAAGGAG
This simply selects 2 random sequence headers (those lines from A.fasta with even indices in data) and the line following it.
If your file is large then external modules might have optimisations to cope with larger data sets.
Don't know much about Fasta, but Python has a Fasta module (you need to install it first).
>>> from pyfasta import Fasta
>>> f = Fasta('tests/test1.fasta')
>>> sorted(f.keys())
['chr1', 'chr2', 'chr3']
Then you can use the sample function from Python's Random module and pick as many as you want at random...
from random import sample
sample(f, how_many_you_want)
import sys,random
from Bio import SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.Alphabet import generic_protein
# Use: python scriptname.py number_of_random_seq infile.fasta outfile.fasta
infile = sys.argv[2] #Name of the input file
seq = list(SeqIO.parse(infile,"fasta")) #Create a list with all the sequence records
print "Input fasta file = ", infile
totseq = len(seq) #Total number of sequences in the input file
print "Number of sequences in the original file = ", totseq
randseq = int(sys.argv[1]) #Number of random sequences desired
print "Number of random sequences desired = ", randseq
if randseq > totseq:
print "The requested number of random sequences is greater that the total number of input sequences. Exiting."
exit()
outfile = sys.argv[3] #Name of the output file
print "Output fasta file = ", outfile
outrandseq = []
outlist = []
print "Randomly chosen output sequences:"
for i in range(randseq):
choose = random.randint(1,totseq-1) #Choose a random sequence record number
for j in range(len(outrandseq)): #Test to see if the random sequence record number has already been chosen
if choose == outrandseq[j]:
choose = random.randint(1,totseq-1) #Choose a new random sequence record number if the current one has already been chosen
outrandseq.append(choose)
print choose
outseq = seq[choose]
outlist.append(outseq) #Append seq record to output list
SeqIO.write(outlist, outfile, "fasta") #Write the output list to the outfile
exit()
import sys,random
from Bio import SeqIO
from Bio.Seq import Seq
from Bio.SeqRecord import SeqRecord
from Bio.Alphabet import generic_protein
# I use this from small numbers of sequences (input file up to 10000 sequences) and it works fine.
# For very large sequence sets it may be too slow -- I just have not tried.
# Use: python scriptname.py number_of_random_seq infile.fasta outfile.fasta
infile = sys.argv[2] #Name of the input file
seq = list(SeqIO.parse(infile,"fasta")) #Create a list with all the sequence records
print "Input fasta file = ", infile
totseq = len(seq) #Total number of sequences in the input file
print "Number of sequences in the original file = ", totseq
numrandseq = int(sys.argv[1]) #Number of random sequences desired
print "Number of random sequences desired = ", numrandseq
if numrandseq > totseq:
print "The requested number of random sequences is greater that the total number of input sequences. Exiting."
exit()
outfile = sys.argv[3] #Name of the output file
print "Output fasta file = ", outfile
outrandseqset = []
i = 1
for i in range(numrandseq): #Create a list of random sequence record numbers for output
choice = random.randint(1,totseq)
outrandseqset.append(choice)
i = 1
j = 1
duplicate = 1
while duplicate: #Make sure no sequences are duplicated in the list
duplicate = 0
for i in range(numrandseq):
for j in range(i+1, numrandseq):
if outrandseqset[i] == outrandseqset[j]:
outrandseqset[j] = random.randint(1,totseq)
duplicate = 1
i = 1
print "Randomly chosen output sequences:"
for i in range(numrandseq):
print outrandseqset[i]
outlist = []
i = 1
for i in range(numrandseq): #Create the list of seq records to be written to the output file
seqnum = outrandseqset[i]
outseq = seq[seqnum]
outlist.append(outseq)
SeqIO.write(outlist, outfile, "fasta") #Write the output list to the outfile
exit()
Depends if you have unix sort or shuf installed. If so, its very easy Select random 3000 lines from a file with awk codes
- Create a list of headers
grep '>' A.fasta >FILE
- Then select 2 random lines from that file
CONTIGS=
sort -R FILE | head -n2|tr "\n" " "
or
CONTIGS=
shuf -n2 FILE|tr "\n" " "
Then, use samtools to extract
samtools faidx A.fasta $CONTIGS
来源:https://stackoverflow.com/questions/31265282/how-to-randomly-extract-fasta-sequences-using-python