fasta

I have a small fasta file of DNA sequences which looks like this: >NM_000016 700 200 234 ACATATTGGAGGCCGAAACAATGAGGCGTGATCAACTCAGTATATCAC >NM_000775 700 124 236 CTAACCTCTCCCAGTGTGGAACCTCTATCTCATGAGAAAGCTGGGATGAG >NM_003820 700 111 222 ATTTCCTCCTGCTGCCCGGGAGGTAACACCCTGGACCCCTGGAGTCTGCA Questions: 1) How can I read this fasta file into R as a dataframe where each row is a sequence record, the 1st column is the refseqID and the 2nd column is the sequence. 2) How to extract subsequence at (start, end) location? NM_000016 1 3 #"ACA" NM_000775 2 6 #"TAACC" NM_003820 3 5 #"TTC" You should have a look

I have a fasta file where the sequences are broken up with newlines. I'd like to remove the newlines. Here's an example of my file: >accession1 ATGGCCCATG GGATCCTAGC >accession2 GATATCCATG AAACGGCTTA I'd like to convert it into this: >accession1 ATGGCCCATGGGATCCTAGC >accession2 GATATCCATGAAACGGCTTA I found a potential solution on this site , which looks like this: cat input.fasta | awk '{if (substr($0,1,1)==">"){if (p){print "\n";} print $0} else printf("%s",$0);p++;}END{print "\n"}' > joinedlineoutput.fasta However, this places an extra line break between each entry, so file looks like this:

I have the following sequences which is in a fasta format with sequence header and its nucleotides. How can I randomly extract the sequences. For example I would like to randomly select 2 sequences out of the total sequences. There are tools provided to do so is to extract according to percentage but not the number of sequences. Can anyone help me? A.fasta >chr1:1310706-1310726 GACGGTTTCCGGTTAGTGGAA >chr1:901959-901979 GAGGGCTTTCTGGAGAAGGAG >chr1:983001-983021 GTCCGCTTGCGGGACCTGGGG >chr1:984333-984353 CTGGAATTCCGGGCGCTGGAG >chr1:1154147-1154167 GAGATCGTCCGGGACCTGGGT Expected Output >chr1

I am trying to parse a large fasta file and I am encountering out of memory errors. Some suggestions to improve the data handling would be appreciated. Currently the program correctly prints out the names however partially through the file I get a MemoryError Here is the generator def readFastaEntry( fp ): name = "" seq = "" for line in fp: if line.startswith( ">" ): tmp = [] tmp.append( name ) tmp.append( seq ) name = line seq = "" yield tmp else: seq = seq.join( line ) and here is the caller stub more will be added after this part works fp = open( sys.argv[1], 'r' ) for seq in readFastaEntry