fasta

I have a FASTA file that can easily be parsed by SeqIO.parse . I am interested in extracting sequence ID's and sequence lengths. I used these lines to do it, but I feel it's waaaay too heavy (two iterations, conversions, etc.) from Bio import SeqIO import pandas as pd # parse sequence fasta file identifiers = [seq_record.id for seq_record in SeqIO.parse("sequence.fasta", "fasta")] lengths = [len(seq_record.seq) for seq_record in SeqIO.parse("sequence.fasta", "fasta")] #converting lists to pandas Series s1 = Series(identifiers, name='ID') s2 = Series(lengths, name='length') #Gathering Series

I have tried the mathematica code for making the chaos game for DNA sequences posted in this address: http://facstaff.unca.edu/mcmcclur/blog/GeneCGR.html which is like this: genome = Import["c:\data\sequence.fasta", "Sequence"]; genome = StringReplace[ToString[genome], {"{" -> "", "}" -> ""}]; chars = StringCases[genome, "G" | "C" | "T" | "A"]; f[x_, "A"] := x/2; f[x_, "T"] := x/2 + {1/2, 0}; f[x_, "G"] := x/2 + {1/2, 1/2}; f[x_, "C"] := x/2 + {0, 1/2}; pts = FoldList[f, {0.5, 0.5}, chars]; Graphics[{PointSize[Tiny], Point[pts]}] the fasta sequence that I have is just a sequence of letters

I have the following FASTA file: >header1 CGCTCTCTCCATCTCTCTACCCTCTCCCTCTCTCTCGGATAGCTAGCTCTTCTTCCTCCT TCCTCCGTTTGGATCAGACGAGAGGGTATGTAGTGGTGCACCACGAGTTGGTGAAGC >header2 GGT >header3 TTATGAT My desired output: >header1 117 >header2 3 >header3 7 # 3 sequences, total length 127. This is my code: awk '/^>/ {print; next; } { seqlen = length($0); print seqlen}' file.fa The output I get with this code is: >header1 60 57 >header2 3 >header3 7 I need a small modification in order to deal with multiple sequence lines. I also need a way to have the total sequences and total length. Any suggestion will

I have an input_file.fa file like this ( FASTA format): > header1 description data data data >header2 description more data data data I want to read in the file one chunk at a time, so that each chunk contains one header and the corresponding data, e.g. block 1: > header1 description data data data Of course I could just read in the file like this and split: with open("1.fa") as f: for block in f.read().split(">"): pass But I want to avoid the reading the whole file into memory , because the files are often large. I can read in the file line by line of course: with open("input_file.fa") as f:

Last week I decided to give a try to Perl6 and started to reimplement one of my program. I have to say, Perl6 is so the easy for object programming, an aspect very painfull to me in Perl5. My program have to read and store big files, such as whole genomes (up to 3 Gb and more, See example 1 below) or tabulate data. The first version of the code was made in the Perl5 way by iterating line by line ("genome.fa".IO.lines). It was very slow and unsable for a correct execution time. my class fasta { has Str $.file is required; has %!seq; submethod TWEAK() { my $id; my $s; for $!file.IO.lines ->