string-matching

DT <- data.table(num=c("20031111","1112003","23423","2222004"),y=c("2003","2003","2003","2004")) > DT num y 1: 20031111 2003 2: 1112003 2003 3: 23423 2003 4: 2222004 2004 I want to compare the two cell content, and perform an action based on the boolean value. for instance, if "num" matches the year, create a column x holding that value. I thought about subsetting based on grep, and that works, but naturally checks the whole column every time which seems wasteful DT[grep(y,num)] # works with a pattern>1 warning I could apply() my way but perhaps there's a data.table way? Thanks Nick Kennedy If

I have a data.table with a character column, and want to select only those rows that contain a substring in it. Equivalent to SQL WHERE x LIKE '%substring%' E.g. > Months = data.table(Name = month.name, Number = 1:12) > Months["mb" %in% Name] Empty data.table (0 rows) of 2 cols: Name,Number How would I select only the rows where Name contains "mb"? data.table has a like function. Months[like(Name,"mb")] Name Number 1: September 9 2: November 11 3: December 12 Or, %like% looks nicer : > Months[Name %like% "mb"] Name Number 1: September 9 2: November 11 3: December 12 Note that %like% and like()

I need to find all matches in a string for a given regex. I've been using findall() to do that until I came across a case where it wasn't doing what I expected. For example: regex = re.compile('(\d+,?)+') s = 'There are 9,000,000 bicycles in Beijing.' print re.search(regex, s).group(0) > 9,000,000 print re.findall(regex, s) > ['000'] In this case search() returns what I need (the longest match) but findall() behaves differently, although the docs imply it should be the same: findall() matches all occurrences of a pattern, not just the first one as search() does. Why is the behaviour different?

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite). I am not sure how large the genome is, but much longer than 230,000 sequences. I need to look for each of my sequences of 25 characters, for example, (AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string, i.e. (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT....) I don't care where or how many times it is found, only whether it is or not. This is

Given a value I want to validate it to check if it is a valid year. My criteria is simple where the value should be an integer with 4 characters. I know this is not the best solution as it will not allow years before 1000 and will allow years such as 5000 . This criteria is adequate for my current scenario. What I came up with is \d{4}$ While this works it also allows negative values. How do I ensure that only positive integers are allowed? You need to add a start anchor ^ as: ^\d{4}$ Your regex \d{4}$ will match strings that end with 4 digits . So input like -1234 will be accepted. By adding

How do I check if a string matches this pattern? Uppercase letter, number(s), uppercase letter, number(s)... Example, These would match: A1B2 B10L1 C1N200J1 These wouldn't ('^' points to problem) a1B2 ^ A10B ^ AB400 ^ CrazyCasta import re pattern = re.compile("^([A-Z][0-9]+)+$") pattern.match(string) Edit: As noted in the comments match checks only for matches at the beginning of the string while re.search() will match a pattern anywhere in string. (See also: https://docs.python.org/library/re.html#search-vs-match ) One-liner: re.match(r"pattern", string) # No need to compile import re >>> if