pattern-matching

I was reading this post and I wonder if someone can find the way to catch repetitive motifs into a more complex string. For example, find all the repetitive motifs in string = 'AAACACGTACGTAATTCCGTGTGTCCCCTATACGTATACGTTT' Here the repetitive motifs: 'AAAC ACGTACGT AATTCC GTGTGT CCCC TATACGTATACG TTT' So, the output should be something like this: output = {'ACGT': {'repeat': 2, 'region': (5,13)}, 'GT': {'repeat': 3, 'region': (19,24)}, 'TATACG': {'repeat': 2, 'region': (29,40)}} This example comes from a typical biological phenomena termed microsatellite which is present into the DNA. UPDATE 1:

I just started learning Haskell and I'm trying to use pattern matching to match a list that has exactly 2 elements. As an exercise, I'm trying to write a function which returns the one but last element from a list. So far I found this: myButLast :: [a] -> a myButLast [] = error "Cannot take one but last from empty list!" myButLast [x] = error "Cannot take one but last from list with only one element!" myButLast [x:y] = x myButLast (x:xs) = myButLast xs Now the line with myButLast [x:y] is clearly incorrect, but I don't know how to match a list that has exactly 2 elements, as that is what I'm

I'm looking for a pragma that will warn on a particular incomplete pattern. It would make the compiler fail with the following (hypothetical) code: {-# FAILIF incomplete-patterns #-} f :: Int -> Int f 0 = 0 I am trying to write a "compiler" using Arrows, and knowing pattern matching is complete would help isolate bugs. Thanks! You can require warnings, including incomplete patterns, with -Wall : {-# OPTIONS_GHC -Wall #-} module A where f :: Int -> Int f 0 = 0 Yielding: A.hs:6:1: Warning: Pattern match(es) are non-exhaustive In an equation for `f': Patterns not matched: GHC.Types.I# #x with #x

The following doesn't work. object Foo { def union(s: Set[Int], t: Set[Int]): Set[Int] = t match { case isEmpty => s case (x:xs) => union(s + x, xs) case _ => throw new Error("bad input") } } error: not found: type xs How can I pattern match over a set? Well, x:xs means x of type xs , so it wouldn't work. But, alas, you can't pattern match sets, because sets do not have a defined order. Or, more pragmatically, because there's no extractor on Set . You can always define your own, though: object SetExtractor { def unapplySeq[T](s: Set[T]): Option[Seq[T]] = Some(s.toSeq) } For example: scala> Set

I need some help with pattern matching in R. I need to extract a whole word that starts with a common prefix, from a long character string. The word I want to extract always starts with the same prefix (AA), but the word is not the same length, and does not occur in the same location of the string. mytext1 <- as.character("HORSE MONKEY LIZARD AA12345 SWORDFISH") # Return AA12345 mytext2 <- as.character("ELEPHANT AA100 KOALA POLAR.BEAR") # Want to return AA100 mytext3 <- as.character("CROCODILE DRAGON.FLY ANTELOPE") # Want to return NA As an extension of this, what if there were two different

Is it recommended to always have exhaustive pattern matches in Haskell, even for "impossible" cases? For example, in the following code, I am pattern matching on the "accumulator" of a foldr. I am in complete control of the contents of the accumulator, because I create it (it is not passed to me as input, but rather built within my function). Therefore, I know certain patterns should never match it. If I strive to never get the "Pattern match(es) are non-exhaustive" error, then I would place a pattern match for it that simply error's with the message "This pattern should never happen." Much

I'm having problems finding the answer here, on google or in the docs ... I need to do a case insensitive select against an array type. So if: value = {"Foo","bar","bAz"} I need SELECT value FROM table WHERE 'foo' = ANY(value) to match. I've tried lots of combinations of lower() with no success. ILIKE instead of = seems to work but I've always been nervous about LIKE - is that the best way? Craig Ringer One alternative not mentioned is to install the citext extension that comes with PostgreSQL 8.4+ and use an array of citext : regress=# CREATE EXTENSION citext; regress=# SELECT 'foo' = ANY( '{