awk

问题 I have two files The gene list file looks like this LOC_Os06g12230.1 Pavir.Ab03005 Pavir.J14065 ChrUn.fgenesh Sevir.1G325700 LOC_Os02g51280.1 Bradi3g59320 Brast04G017400 Fasta sequence file looks like this >LOC_Os03g57190.1 pacid=33130570 polypeptide=LOC_Os03g57190.1 locus=LOC_Os03g57190 ID=LOC_Os03g57190.1.MSUv7.0 annot-version=v7.0 ATGGAGGCGGCGGTGGGGGACGGGGAAGGCGGTGGCGGCGGCGGCGGGCGGGGGAAGCGTGGGCGGGGAGGAGGAGGAGG GGAGATGGTGGAGGCGGTGTGGGGGCAGACGGGGAGTACGGCGTCGCGGATCTACAGGGTGAGGGCGACGGGGGGGAAGG

问题 I have two files The gene list file looks like this LOC_Os06g12230.1 Pavir.Ab03005 Pavir.J14065 ChrUn.fgenesh Sevir.1G325700 LOC_Os02g51280.1 Bradi3g59320 Brast04G017400 Fasta sequence file looks like this >LOC_Os03g57190.1 pacid=33130570 polypeptide=LOC_Os03g57190.1 locus=LOC_Os03g57190 ID=LOC_Os03g57190.1.MSUv7.0 annot-version=v7.0 ATGGAGGCGGCGGTGGGGGACGGGGAAGGCGGTGGCGGCGGCGGCGGGCGGGGGAAGCGTGGGCGGGGAGGAGGAGGAGG GGAGATGGTGGAGGCGGTGTGGGGGCAGACGGGGAGTACGGCGTCGCGGATCTACAGGGTGAGGGCGACGGGGGGGAAGG

问题 i have a json containing an array of objects, every object contains a unique value in: "id":"value" i've followed this other answer and i can split the whole document in multiple files using jq and awk jq -c ".[]" big.json | gawk '{print > "doc00" NR ".json";}' in this way the output files are named sequentially. how i can name the files using the id value? 回答1: For each element in the array, print id and the element itself in two separate lines, thus you can grab the id from odd numbered

问题 Let's say I'm opening a large (several GB) file where I cannot read in the entire file as once. If it's a csv file, we would use: for chunk in pd.read_csv('path/filename', chunksize=10**7): # save chunk to disk Or we could do something similar with pandas: import pandas as pd with open(fn) as file: for line in file: # save line to disk, e.g. df=pd.concat([df, line_data]), then save the df How does one "chunk" data with an awk script? Awk will parse/process text into a format you desire, but I

问题 Let's say I'm opening a large (several GB) file where I cannot read in the entire file as once. If it's a csv file, we would use: for chunk in pd.read_csv('path/filename', chunksize=10**7): # save chunk to disk Or we could do something similar with pandas: import pandas as pd with open(fn) as file: for line in file: # save line to disk, e.g. df=pd.concat([df, line_data]), then save the df How does one "chunk" data with an awk script? Awk will parse/process text into a format you desire, but I

问题 Let's say I'm opening a large (several GB) file where I cannot read in the entire file as once. If it's a csv file, we would use: for chunk in pd.read_csv('path/filename', chunksize=10**7): # save chunk to disk Or we could do something similar with pandas: import pandas as pd with open(fn) as file: for line in file: # save line to disk, e.g. df=pd.concat([df, line_data]), then save the df How does one "chunk" data with an awk script? Awk will parse/process text into a format you desire, but I

问题 I have two separate files, each containing a different number of columns which I want to merge based on data in multiple columns. file1 VMNF01000015.1 1769465 1769675 . . - Focub_II5_mimp_1 VMNF01000014.1 3225875 3226081 . . + Focub_II5_mimp_1 VMNF01000014.1 3226046 3226081 . . - Focub_II5_mimp_1 VMNF01000014.1 3585246 3585281 . . - Focub_II5_mimp_1 VMNF01000014.1 3692468 3692503 . . - Focub_II5_mimp_1 VMNF01000014.1 3715380 3715415 . . + Focub_II5_mimp_1 VMNF01000014.1 2872478 2872511 . . -

问题 I am trying to extract the following output from the following file: xr_lab# show clock Thu Sep 19 14:38:02.812 WIB 14:38:02.893 WIB Thu Sep 19 2019 xr_lab# xr_lab# xr_lab#show memory compare report Thu Sep 19 14:41:08.084 WIB PID NAME MEM BEFORE MEM AFTER DIFFERENCE MALLOCS-NEW ------------------------------------------------------------------------------- 6777 ospf 24292985 24293753 768 272634 7582 mibd_interface 8670334 8484152 -186182 267657 xr_lab#show clock Thu Sep 19 14:42:42.425 WIB

问题 I hope can you help me, essentially, I'm looking for the Powershell equivalent of the awk command: awk '/"Box11"/ { print $0 }' test.txt|awk '{ SUM += $4} END { print SUM} ' 回答1: Multiple ways of doing it but this would do the trick: Get-Content c:\temp\test.txt | Where-Object{$_ -match '"Box11"'} | ForEach-Object{($_ -split "\s+")[3]} | Measure-Object -Sum | Select-Object -ExpandProperty Sum Get a string array of the file. For each line that contains the string "Box11" we split the line on

问题 I use uniq -c some text file. Its output like this: 123(space)first word(tab)other things 2(space)second word(tab)other things .... So I need extract total number(like 123 and 2 above), but I can't figure out how to, because if I split this line by space, it will like this ['123', 'first', 'word(tab)other', 'things'] . I want to know why doesn't it output with tab? And how to extract total number in shell? ( I finally extract it with python, WTF) Update : Sorry, I didn't describe my question