问题
I\'m having a bit of trouble getting a Python regex to work when matching against text that spans multiple lines. The example text is (\'\\n\' is a newline)
some Varying TEXT\\n
\\n
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF\\n
[more of the above, ending with a newline]\\n
[yep, there is a variable number of lines here]\\n
\\n
(repeat the above a few hundred times).
I\'d like to capture two things: the \'some_Varying_TEXT\' part, and all of the lines of uppercase text that comes two lines below it in one capture (i can strip out the newline characters later). I\'ve tried with a few approaches:
re.compile(r\"^>(\\w+)$$([.$]+)^$\", re.MULTILINE) # try to capture both parts
re.compile(r\"(^[^>][\\w\\s]+)$\", re.MULTILINE|re.DOTALL) # just textlines
and a lot of variations hereof with no luck. The last one seems to match the lines of text one by one, which is not what I really want. I can catch the first part, no problem, but I can\'t seem to catch the 4-5 lines of uppercase text. I\'d like match.group(1) to be some_Varying_Text and group(2) to be line1+line2+line3+etc until the empty line is encountered.
If anyone\'s curious, its supposed to be a sequence of aminoacids that make up a protein.
回答1:
Try this:
re.compile(r"^(.+)\n((?:\n.+)+)", re.MULTILINE)
I think your biggest problem is that you're expecting the ^ and $ anchors to match linefeeds, but they don't. In multiline mode, ^ matches the position immediately following a newline and $ matches the position immediately preceding a newline.
Be aware, too, that a newline can consist of a linefeed (\n), a carriage-return (\r), or a carriage-return+linefeed (\r\n). If you aren't certain that your target text uses only linefeeds, you should use this more inclusive version of the regex:
re.compile(r"^(.+)(?:\n|\r\n?)((?:(?:\n|\r\n?).+)+)", re.MULTILINE)
BTW, you don't want to use the DOTALL modifier here; you're relying on the fact that the dot matches everything except newlines.
回答2:
This will work:
>>> import re
>>> rx_sequence=re.compile(r"^(.+?)\n\n((?:[A-Z]+\n)+)",re.MULTILINE)
>>> rx_blanks=re.compile(r"\W+") # to remove blanks and newlines
>>> text="""Some varying text1
...
... AAABBBBBBCCCCCCDDDDDDD
... EEEEEEEFFFFFFFFGGGGGGG
... HHHHHHIIIIIJJJJJJJKKKK
...
... Some varying text 2
...
... LLLLLMMMMMMNNNNNNNOOOO
... PPPPPPPQQQQQQRRRRRRSSS
... TTTTTUUUUUVVVVVVWWWWWW
... """
>>> for match in rx_sequence.finditer(text):
... title, sequence = match.groups()
... title = title.strip()
... sequence = rx_blanks.sub("",sequence)
... print "Title:",title
... print "Sequence:",sequence
... print
...
Title: Some varying text1
Sequence: AAABBBBBBCCCCCCDDDDDDDEEEEEEEFFFFFFFFGGGGGGGHHHHHHIIIIIJJJJJJJKKKK
Title: Some varying text 2
Sequence: LLLLLMMMMMMNNNNNNNOOOOPPPPPPPQQQQQQRRRRRRSSSTTTTTUUUUUVVVVVVWWWWWW
Some explanation about this regular expression might be useful: ^(.+?)\n\n((?:[A-Z]+\n)+)
- The first character (
^) means "starting at the beginning of a line". Be aware that it does not match the newline itself (same for $: it means "just before a newline", but it does not match the newline itself). - Then
(.+?)\n\nmeans "match as few characters as possible (all characters are allowed) until you reach two newlines". The result (without the newlines) is put in the first group. [A-Z]+\nmeans "match as many upper case letters as possible until you reach a newline. This defines what I will call a textline.((?:textline)+)means match one or more textlines but do not put each line in a group. Instead, put all the textlines in one group.- You could add a final
\nin the regular expression if you want to enforce a double newline at the end. - Also, if you are not sure about what type of newline you will get (
\nor\ror\r\n) then just fix the regular expression by replacing every occurrence of\nby(?:\n|\r\n?).
回答3:
If each file only has one sequence of aminoacids, I wouldn't use regular expressions at all. Just something like this:
def read_amino_acid_sequence(path):
with open(path) as sequence_file:
title = sequence_file.readline() # read 1st line
aminoacid_sequence = sequence_file.read() # read the rest
# some cleanup, if necessary
title = title.strip() # remove trailing white spaces and newline
aminoacid_sequence = aminoacid_sequence.replace(" ","").replace("\n","")
return title, aminoacid_sequence
回答4:
find:
^>([^\n\r]+)[\n\r]([A-Z\n\r]+)
\1 = some_varying_text
\2 = lines of all CAPS
Edit (proof that this works):
text = """> some_Varying_TEXT
DSJFKDAFJKDAFJDSAKFJADSFLKDLAFKDSAF
GATACAACATAGGATACA
GGGGGAAAAAAAATTTTTTTTT
CCCCAAAA
> some_Varying_TEXT2
DJASDFHKJFHKSDHF
HHASGDFTERYTERE
GAGAGAGAGAG
PPPPPAAAAAAAAAAAAAAAP
"""
import re
regex = re.compile(r'^>([^\n\r]+)[\n\r]([A-Z\n\r]+)', re.MULTILINE)
matches = [m.groups() for m in regex.finditer(text)]
for m in matches:
print 'Name: %s\nSequence:%s' % (m[0], m[1])
回答5:
The following is a regular expression matching a multiline block of text:
import re
result = re.findall('(startText)(.+)((?:\n.+)+)(endText)',input)
回答6:
My preference.
lineIter= iter(aFile)
for line in lineIter:
if line.startswith( ">" ):
someVaryingText= line
break
assert len( lineIter.next().strip() ) == 0
acids= []
for line in lineIter:
if len(line.strip()) == 0:
break
acids.append( line )
At this point you have someVaryingText as a string, and the acids as a list of strings.
You can do "".join( acids ) to make a single string.
I find this less frustrating (and more flexible) than multiline regexes.
来源:https://stackoverflow.com/questions/587345/regular-expression-matching-a-multiline-block-of-text