How To Do Clojure Program? [closed]

问题

Closed. This question is off-topic. It is not currently accepting answers.

---

Want to improve this question? Update the question so it's on-topic for Stack Overflow.

Closed 4 years ago.

I am learner, just now started learning regarding this..

Can anyone help me out???

Write a clojure program a function, most-frequent-word, which has two arguments. The first argument is a string, the second argument is an integer, call it n. most-frequent-word returns a sequence word(s) of length n that occurs most in the string. For example (most-frequent-word “TCGAAGCTAGACGCTAGTAGCTAGTGTGCA” 4) returns (“CTAG” “GCTA”)

回答1:

Tips to start:

Some tips to try and get you started:

1. You can use partition to turn the string into a sequence of "words". Remember to provide a step argument of 1, so you get all the possible overlapping subsequences.
2. frequencies counts how many times things (including sequences) appear in a collection.
3. max or max-key search for the highest values among their inputs. Use apply to plumb the contents of a collection into them as individual inputs.
4. partition will output sequences of characters, not strings. You can turn those back into strings with clojure.string/join.

I can get more explicit if you like, but for a beginner there's also a lot of value in experimenting with these at the REPL and trying to work it out for yourself.

Edit: My solution:

Right, this particular step was a bit obscure. Since you want all the strings that have maximal frequency you need to do something a bit more than just max-key. The way I did it was to first find the max of the frequency values, then filter out any key/frequency pairs with a different frequency than that.

(defn most-frequent-word [string n]
  (let[freqs (->> string
                  (partition n 1)
                  frequencies)
       biggest-value (apply max (vals freqs))
       maximal-pairs (filter #(= biggest-value (val %)) freqs)]
    (map #(clojure.string/join (key %)) maximal-pairs )))

This isn't quite ideal from a performance standpoint, but seemed to have a cleaner separation of concerns (and hopefully be easier to understand) than trying to do both jobs in one iteration.

来源：https://stackoverflow.com/questions/32817366/how-to-do-clojure-program