I am trying to parse a large fasta file and I am encountering out of memory errors. Some suggestions to improve the data handling would be appreciated. Currently the program
A pyparsing parser for this format is only a few lines long. See the annotations in the following code:
data = """>1 (PB2)
AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATAC
TCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCC
TGCACTCAGGATGAAGTGGATGATG
>2 (PB1)
AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACC
ACATTTCCCTATACTGGAGACCCTCC"""
from pyparsing import Word, nums, QuotedString, Combine, OneOrMore
# define some basic forms
integer = Word(nums)
key = QuotedString("(", endQuoteChar=")")
# sequences are "words" made up of the characters A, G, C, and T
# we want to match one or more of them, and have the parser combine
# them into a single string (Combine by default requires all of its
# elements to be adjacent within the input string, but we want to allow
# for the intervening end of lines, so we add adjacent=False)
sequence = Combine(OneOrMore(Word("AGCT")), adjacent=False)
# define the overall pattern to scan for - attach results names
# to each matched element
seqEntry = ">" + integer("index") + key("key") + sequence("sequence")
for seq,s,e in seqEntry.scanString(data):
# just dump out the matched data
print seq.dump()
# could also access fields as seq.index, seq.key and seq.sequence
Prints:
['>', '1', 'PB2', 'AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCCTGCACTCAGGATGAAGTGGATGATG']
- index: 1
- key: PB2
- sequence: AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCCTGCACTCAGGATGAAGTGGATGATG
['>', '2', 'PB1', 'AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACCACATTTCCCTATACTGGAGACCCTCC']
- index: 2
- key: PB1
- sequence: AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACCACATTTCCCTATACTGGAGACCCTCC
Without having a great understanding of what you are doing, I would have written the code like this:
def readFastaEntry( fp ):
name = ""
while True:
line = name or f.readline()
if not line:
break
seq = []
while True:
name = f.readline()
if not name or name.startswith(">"):
break
else:
seq.append(name)
yield (line, "".join(seq))
This gathers up the data after a starting line up to the next starting line. Making seq an array means that you minimize the string joining until the last possible moment. Yielding a tuple makes more sense than a list.
Have you considered using BioPython. They have a sequence reader that can read fasta files. And if you are interested in coding one yourself, you can take a look at BioPython's code.
Edit: Code added
def read_fasta(fp):
name, seq = None, []
for line in fp:
line = line.rstrip()
if line.startswith(">"):
if name: yield (name, ''.join(seq))
name, seq = line, []
else:
seq.append(line)
if name: yield (name, ''.join(seq))
with open('f.fasta') as fp:
for name, seq in read_fasta(fp):
print(name, seq)
def read_fasta(filename):
name = None
with open(filename) as file:
for line in file:
if line[0] == ">":
if name:
yield (name, seq)
name = line[1:-1].split("|")[0]
seq = ""
else:
seq += line[:-1]
yield (name, seq)