Save complete web page (incl css, images) using python/selenium

Question

I am using Python/Selenium to submit genetic sequences to an online database, and want to save the full page of results I get back. Below is the code that gets me to the res

Answer 1

This is not a perfect solution, but it will get you most of what you need. You can replicate the behavior of "save as full web page (complete)" by parsing the html and downloading any loaded files (images, css, js, etc.) to their same relative path.

Most of the javascript won't work due to cross origin request blocking. But the content will look (mostly) the same.

This uses requests to save the loaded files, lxml to parse the html, and os for the path legwork.

from selenium import webdriver
import chromedriver_binary
from lxml import html
import requests
import os

driver = webdriver.Chrome()
URL = 'https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome'
SEQUENCE = 'CCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACAGCTCAAACACAAAGTTACCTAAACTATAGAAGGACA' 
base = 'https://blast.ncbi.nlm.nih.gov/'

driver.get(URL)
seq_query_field = driver.find_element_by_id("seq")
seq_query_field.send_keys(SEQUENCE)
blast_button = driver.find_element_by_id("b1")
blast_button.click()

content = driver.page_source
# write the page content
os.mkdir('page')
with open('page/page.html', 'w') as fp:
    fp.write(content)

# download the referenced files to the same path as in the html
sess = requests.Session()
sess.get(base)            # sets cookies

# parse html
h = html.fromstring(content)
# get css/js files loaded in the head
for hr in h.xpath('head//@href'):
    if not hr.startswith('http'):
        local_path = 'page/' + hr
        hr = base + hr
    res = sess.get(hr)
    if not os.path.exists(os.path.dirname(local_path)):
        os.makedirs(os.path.dirname(local_path))
    with open(local_path, 'wb') as fp:
        fp.write(res.content)

# get image/js files from the body.  skip anything loaded from outside sources
for src in h.xpath('//@src'):
    if not src or src.startswith('http'):
        continue
    local_path = 'page/' + src
    print(local_path)
    src = base + src
    res = sess.get(hr)
    if not os.path.exists(os.path.dirname(local_path)):
        os.makedirs(os.path.dirname(local_path))
    with open(local_path, 'wb') as fp:
        fp.write(res.content)  

You should have a folder called page with a file called page.html in it with the content you are after.