Remove line breaks in a FASTA file

Question

I have a fasta file where the sequences are broken up with newlines. I\'d like to remove the newlines. Here\'s an example of my file:

>accession1
ATGGCC         


        

Answer 1

This awk program:

% awk '!/^>/ { printf "%s", $0; n = "\n" } 
/^>/ { print n $0; n = "" }
END { printf "%s", n }
' input.fasta

Will yield:

>accession1
ATGGCCCATGGGATCCTAGC
>accession2
GATATCCATGAAACGGCTTA

Explanation:

On lines that don't start with a >, print the line without a line break and store a newline character (in variable n) for later.

On lines that do start with a >, print the stored newline character (if any) and the line. Reset n, in case this is the last line.

End with a newline, if required.

Note:

By default, variables are initialized to the empty string. There is no need to explicitly "initialize" a variable in awk, which is what you would do in c and in most other traditional languages.

--6.1.3.1 Using Variables in a Program, The GNU Awk User's Guide