Perl while loops and reading lines

问题

Each record has 4 lines:

Like the following:

@NCYC36111a03.q1k bases 1 to 1576
GCGTGCCCGAAAAAATGCTTTTGGAGCCGCGCGTGAAAT
+
!)))))****(((***%%((((*(((+,**(((+**+,

There are two files in which 1 file corresponded to the other

there are an array of seqeunces A1 So read 1 record at a time from file 1. read record from file 2. if the sequence in record 1 file 1 (line 2) matches the seuqnece in the array A1, i print the record from file 2 to an output file so on...but the point is i need to read a record at a time.... how would i break out of the inner loop so that i can read the next record from the file 1 and then compare it to the next record in file 2

回答1:

If you ask about controlling nested loops you can do that with labels.

Example:

OUTER:
while(<>){
    for(@something){
        last OUTER;
    }
}

See last for example.

回答2:

In case only lines with same number could ever match, you don't really need more than one loop. You can call reading operation (<>, read, sysread) wherever you want. It only usually placed directly in loop because it conveniently returns undef and breaks it when work is done.

while(defined(my $first_line = <FIRST>)){
   my $second_line = <SECOND>;
   if($first_line eq $second_line){
      print "match\n";
   } else {
      print "no match\n";
   }
}

回答3:

From your sentence I need to check if the sequence matches any with the sequence from the second I gather that you want to check whether any lines in the two files match?

If you need to read a file several times then you can use seek to rewind to the start of it without reopening it.

This program shows the idea.

use strict;
use warnings;

open my $fh1, '<', 'file1' or die $!;
open my $fh2, '<', 'file2' or die $!;

open my $out, '>', 'matches' or die $!;

while (my $line1 = <$fh1>) {

  seek $fh2, 0, 0;

  while (my $line2 = <$fh2>) {

    if ($line1 eq $line2) {
      print $out $line1;
      last;
    }
  }
}

Edit

Your comment has changed the problem. Both files have four-line records and you want to compare the second line in corresponding records across the two files.

use strict;
use warnings;

open my $fh1, '<', 'file1' or die $!;
open my $fh2, '<', 'file2' or die $!;

open my $match, '>', 'matches' or die $!;
open my $nomatch, '>', 'nomatch' or die $!;

while (1) {

  my (@data1, @data2);

  for (1 .. 4) {
    my $line;
    $line = <$fh1>;
    push @data1, $line if defined $line;
    $line = <$fh2>;
    push @data2, $line if defined $line;
  }

  last unless @data1 == 4 and @data2 == 4;

  if ($data1[1] eq $data2[1]) {
    print $match @data2;
  }
  else {
    print $nomatch @data2;
  }
}

回答4:

A full example :

#!/usr/bin/env perl
use strict;
use warnings;

open F1, "<", "/path/1";
open F2, "<", "/path/2";

@a1 = <F1>;
@a2 = <F2>;

for (0..$#a1) {
    if ($a1[$_] eq $a2[$_]) {
        print "MATCH line [$_]\n";
    } else {
        print "DOESN'T MATCH line [$_]\n";
    }
}

来源：https://stackoverflow.com/questions/10899621/perl-while-loops-and-reading-lines

标签

perl

diff