extract

I found out that with ${string:0:3} one can access the first 3 characters of a string. Is there a equivalently easy method to access the last three characters? gniourf_gniourf Last three characters of string : ${string: -3} or ${string:(-3)} (mind the space between : and -3 in the first form). Please refer to the Shell Parameter Expansion in the reference manual : ${parameter:offset} ${parameter:offset:length} Expands to up to length characters of parameter starting at the character specified by offset. If length is omitted, expands to the substring of parameter starting at the character

I have a stack of PDFs - potentially hundreds or thousands. They are not all formatted the same, but any of them MAY have one or more tables with interesting information that I would like to collect into a separate database. Of course, I know I have to write something to do this. Perl is an option for me - or perhaps Java. I don't really care what language so long as it's free (or cheap with a free trial period to ensure it suits my purposes). I'm looking at CAM::Parse (using strawberry Perl), but I'm not sure how to use it to locate and extract tables from the files. I guess I do have a

I have a dictionary d = {1:-0.3246, 2:-0.9185, 3:-3985, ...} . How do I extract all of the values of d into a list l ? Pierre Bourdon If you only need the dictionary keys 1 , 2 , and 3 use: your_dict.keys() . If you only need the dictionary values -0.3246 , -0.9185 , and -3985 use: your_dict.values() . If you want both keys and values use: your_dict.items() which returns a list of tuples [(key1, value1), (key2, value2), ...] . Use values() >>> d = {1:-0.3246, 2:-0.9185, 3:-3985} >>> d.values() <<< [-0.3246, -0.9185, -3985] If you want all of the values, use this: dict_name_goes_here.values()

I have the following sequences which is in a fasta format with sequence header and its nucleotides. How can I randomly extract the sequences. For example I would like to randomly select 2 sequences out of the total sequences. There are tools provided to do so is to extract according to percentage but not the number of sequences. Can anyone help me? A.fasta >chr1:1310706-1310726 GACGGTTTCCGGTTAGTGGAA >chr1:901959-901979 GAGGGCTTTCTGGAGAAGGAG >chr1:983001-983021 GTCCGCTTGCGGGACCTGGGG >chr1:984333-984353 CTGGAATTCCGGGCGCTGGAG >chr1:1154147-1154167 GAGATCGTCCGGGACCTGGGT Expected Output >chr1

I'm trying to find eveything inside a div using regexp. I'm aware that there probably is a smarter way to do this - but I've chosen regexp. so currently my regexp pattern looks like this: $gallery_pattern = '/<div class="gallery">([\s\S]*)<\/div>/'; And it does the trick - somewhat. The problem is if i have two divs after each other - like this. <div class="gallery">text to extract here</div> <div class="gallery">text to extract from here as well</div> I want to extract the information from both divs, but my problem, when testing, is that im not getting the text in between as a result but

I have a VB script that reads the 11th line from a text file. However from that line I need to extract characters 48 through 53 and save it as a variable. After this is accomplished I would like to use that variable and use it in a web url. Example below: Contents of the szCPUSer.dat file look like this: The script I have reads the 10th line Const ForReading = 1 Set objFSO = CreateObject("Scripting.FileSystemObject") Set objTextFile = objFSO.OpenTextFile("szCPUSer.dat", ForReading) For i = 1 to 10 objTextFile.ReadLine Next strLine = objTextFile.ReadLine Wscript.Echo strLine objTextFile.Close I

I tried to ask a question normally once in here but nobody understands what I want to ask. So I've found example in PHP. // $_POST = array('address' => '123', 'name' => 'John Doe'); extract($_POST); echo $address; echo $name is there's a function like extract() in PYTHON????? So the same goes to dictionary: mydict = {'raw':'data', 'code': 500} // some magic to extract raw and code as vars print raw p.s. why I want to do this: when you're in class method, it's damned hard to have 6 manipulation with strings in join() and format() when string is self.data['raw']['code'] (assume it's dict in dict

I have a rasterstack (5 raster layers) that actually is a time series raster. r <- raster(nrow=20, ncol=200) s <- stack( sapply(1:5, function(i) setValues(r, rnorm(ncell(r), i, 3) )) ) s class : RasterStack dimensions : 20, 200, 4000, 5 (nrow, ncol, ncell, nlayers) resolution : 1.8, 9 (x, y) extent : -180, 180, -90, 90 (xmin, xmax, ymin, ymax) coord. ref. : +proj=longlat +datum=WGS84 +ellps=WGS84 +towgs84=0,0,0 names : layer.1, layer.2, layer.3, layer.4, layer.5 min values : -9.012146, -9.165947, -9.707269, -7.829763, -5.332007 max values : 11.32811, 11.97328, 15.99459, 15.66769, 16.72236 My