dna-sequence

I have a DNA sequence and would like to get reverse complement of it using Python. It is in one of the columns of a CSV file and I'd like to write the reverse complement to another column in the same file. The tricky part is, there are a few cells with something other than A, T, G and C. I was able to get reverse complement with this piece of code: def complement(seq): complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'} bases = list(seq) bases = [complement[base] for base in bases] return ''.join(bases) def reverse_complement(s): return complement(s[::-1]) print "Reverse Complement:" print

I am getting a trouble finding an approach to solve this problem. Input-output sequences are as follows : **input1 :** aaagctgctagag **output1 :** a3gct2ag2 **input2 :** aaaaaaagctaagctaag **output2 :** a6agcta2ag Input nsequence can be of 10^6 characters and largest continuous patterns will be considered. For example for input2 "agctaagcta" output will not be "agcta2gcta" but it will be "agcta2". Any help appreciated. Explanation of the algorithm: Having a sequence S with symbols s(1), s(2),…, s(N). Let B(i) be the best compressed sequence with elements s(1), s(2),…,s(i). So, for example, B(3

I'm trying to use haploNet function of {pegas} to plot a haplotype network, but i`m having trouble putting equal haplotypes from different populations in a same piechart. I can build a haplotype net with the following script: x <- read.dna(file="x.fas",format="fasta") h <- haplotype(x) net <- haploNet(h) plot(net) I'd like to set in the dnabin data the label of the original population of each taxa, so i could have piecharts of different colors (of haplotypes from different populations) in the resulting network. I'd like also to remove overlapping circles in the resulting haplotype network.

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite). I am not sure how large the genome is, but much longer than 230,000 sequences. I need to look for each of my sequences of 25 characters, for example, (AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string, i.e. (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT....) I don't care where or how many times it is found, only whether it is or not. This is